Stem-loop sequence gga-mir-6601

AccessionMI0022420 (change log)
DescriptionGallus gallus miR-6601 stem-loop
Stem-loop
   -----ucccacauaggcuguuccugcugg        u    g ucu       uug 
5'                              cugcccag gcca g   caucccu   g
                                |||||||| |||| |   |||||||    
3'                              gacggguc cggu u   guaggga   g
   uacaggacuuccucguggaggguacagga        u    g -cu       cua 
Get sequence
Deep sequencing
44 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 23912031-23912140 [+]
sense
ENSGALT00000015772 ; ASB4-201; intron 1
Database links

Mature sequence gga-miR-6601-3p

Accession MIMAT0025695
Sequence

61 - 

gaugucuguggcucugggcag

 - 81

Get sequence
Deep sequencing40 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).