Stem-loop sequence gga-mir-6602

AccessionMI0022421 (change log)
DescriptionGallus gallus miR-6602 stem-loop
Stem-loop
   cgggcu      c   ---ucc        -----     uu       uu     ug  g 
5'       gcagug uac      gugaggac     aggga  gcagagg  ggagc  ug c
         |||||| |||      ||||||||     |||||  |||||||  |||||  || u
3'       cguuac aug      uacucuug     ucccu  cgucuuu  ucucg  gc g
   ---agu      -   ucgucu        gaccc     -c       --     gu  a 
Get sequence
Deep sequencing
17 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr26: 2287351-2287460 [-]
sense
ENSGALT00000001018 ; SLC41A1-201; exon 10
Clustered miRNAs
< 10kb from gga-mir-6602
gga-mir-6602chr26: 2287351-2287460 [-]
gga-mir-1797chr26: 2279191-2279291 [-]
Database links

Mature sequence gga-miR-6602-5p

Accession MIMAT0025696
Sequence

26 - 

acagggauugcagagguuggag

 - 47

Get sequence
Deep sequencing17 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).