Stem-loop sequence gga-mir-6604

AccessionMI0022423 (change log)
DescriptionGallus gallus miR-6604 stem-loop
Stem-loop
   -------g g    -  -------g      aggcu       ug u     uu  u    c    
5'         g cacc cu        uccugg     ggcacgg  c aggga  uc gugc agc 
           | |||| ||        ||||||     |||||||  | |||||  || |||| || a
3'         c gugg gg        aggacc     ccguguc  g ucccu  ag cacg ucu 
   cguguaga g    a  agaaggug      -----       cu u     -c  u    u    
Get sequence
Deep sequencing
44 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr6: 22353378-22353487 [+]
sense
ENSGALT00000012296 ; RRP12-201; 3'UTR (exon 30)
Database links

Mature sequence gga-miR-6604-5p

Accession MIMAT0025698
Sequence

21 - 

uggcacggugcuagggauuucugu

 - 44

Get sequence
Deep sequencing39 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).