Stem-loop sequence gga-mir-6605

AccessionMI0022424 (change log)
DescriptionGallus gallus miR-6605 stem-loop
Stem-loop
   -----uacau   u  uauu  uuu      c       c     g      aua  a 
5'           uac ga    cu   cuggga ugcagag uucuu aacaag   gc u
             ||| ||    ||   |||||| ||||||| ||||| ||||||   ||  
3'           gug uu    ga   gaccuu acgucuu aagag uuguuc   ug a
   uuuuauaccc   u  -ucc  uuu      -       u     -      gac  u 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 84548705-84548814 [-]
intergenic
Database links

Mature sequence gga-miR-6605-5p

Accession MIMAT0025699
Sequence

26 - 

acugcagagcuucuugaacaaga

 - 48

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).