Stem-loop sequence gga-mir-6606

AccessionMI0022425 (change log)
DescriptionGallus gallus miR-6606 stem-loop
Stem-loop
   -----------ucaca   aa    aac   g --        agcg     ag           
5'                 ggg  gagc   cca c  ccgggagg    ggagg  cgggaggagc 
                   |||  ||||   ||| |  ||||||||    |||||  ||||||||| g
3'                 ccc  cucg   ggu g  ggcccuuc    uuucc  guuuuucuca 
   acuccgcugcacgaga   --    gga   g cc        ---g     -g           
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 76447763-76447872 [-]
intergenic
Database links

Mature sequence gga-miR-6606-5p

Accession MIMAT0025700
Sequence

27 - 

gaggagcgggaggagcggga

 - 46

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).