Stem-loop sequence gga-mir-6607

AccessionMI0022426 (change log)
DescriptionGallus gallus miR-6607 stem-loop
Stem-loop
   -u    c    --c      u      cg  u  u        u  gga     ucu 
5'   cgug ugug   ugcagu cgugcu  gu gg gugggaag ga   ugguc   a
     |||| ||||   |||||| ||||||  || || |||||||| ||   |||||    
3'   guau acau   acguca gcacga  cg cc caccuuuc cu   acuag   a
   uu    -    uuu      c      ag  c  -        -  agc     uga 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr26: 682614-682723 [-]
sense
ENSGALT00000000450 ; PPP1R12B-201; intron 24
Database links

Mature sequence gga-miR-6607-5p

Accession MIMAT0025701
Sequence

26 - 

gguuggugugggaagugaggaugg

 - 49

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).