Stem-loop sequence gga-mir-6609

AccessionMI0022428 (change log)
DescriptionGallus gallus miR-6609 stem-loop
Stem-loop
   ----------aca aa      u  u   u c      -    u  -c    --     cu 
5'              g  ucugca cg ugu g cagagc cagg gc  uggu  gccuc  c
                |  |||||| || ||| | |||||| |||| ||  ||||  |||||   
3'              c  agacgu gu acg c gucucg gucc cg  acua  cggag  a
   uuccgucguccaa cg      c  u   c a      u    c  ac    gu     cc 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 79931571-79931680 [+]
intergenic
Database links

Mature sequence gga-miR-6609-3p

Accession MIMAT0025704
Sequence

62 - 

acagccccugugcucugaccgca

 - 84

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).