Stem-loop sequence gga-mir-6610

AccessionMI0022429 (change log)
DescriptionGallus gallus miR-6610 stem-loop
Stem-loop
   ------------ca    u   u  c  g         -uuu ug a       ----  aaa 
5'               gccc ggc cu uc caugucucc    c  c ucacagu    gc   c
                 |||| ||| || || |||||||||    |  | |||||||    ||   a
3'               cggg ucg gg ag guauagagg    g  g ggugucg    cg   c
   acguaugcguguuc    u   u  u  -         uuuc gu -       agca  agu 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 4915023-4915132 [+]
sense
ENSGALT00000009616 ; OXSR1-201; intron 4
Database links

Mature sequence gga-miR-6610-3p

Accession MIMAT0025705
Sequence

63 - 

uggguggcuuuggagauaugga

 - 84

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).