Stem-loop sequence gga-mir-6611

AccessionMI0022430 (change log)
DescriptionGallus gallus miR-6611 stem-loop
Stem-loop
   --cauuu     -c          gc      gg  c    ga      ----   u 
5'        cugcu  ugguucacau  uuugcu  au cagu  cacuuc    agu u
          |||||  ||||||||||  ||||||  || ||||  ||||||    ||| u
3'        gacga  accaagugug  ggacga  ua gucg  gugaag    ucg c
   uaagauc     ca          aa      ga  a    uc      gacu   u 
Get sequence
Deep sequencing
12 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr9: 12336436-12336545 [-]
intergenic
Database links

Mature sequence gga-miR-6611-5p

Accession MIMAT0025706
Sequence

26 - 

ugcuggauccagugacacuuca

 - 47

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).