Stem-loop sequence gga-mir-6612

AccessionMI0022431 (change log)
DescriptionGallus gallus miR-6612 stem-loop
Stem-loop
   -------------auguuggugcauaca     c     -      ac    cu   u    g 
5'                             cauca cacag ggcacc  caug  gug gugc u
                               ||||| ||||| ||||||  ||||  ||| ||||  
3'                             guggu guguc cugugg  guac  cac uaug u
   caccgcgggguaguccuaacauacauac     u     a      -a    --   -    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence gga-miR-6612-5p

Accession MIMAT0025707
Sequence

20 - 

accacagggcaccaccaugcug

 - 41

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).