Stem-loop sequence gga-mir-6613

AccessionMI0022432 (change log)
DescriptionGallus gallus miR-6613 stem-loop
Stem-loop
   cauauuaaaaa         -   c   c        c    a    agu  g  a 
5'            ccaagucac uga uuc uucagcuc agug uagu   gu ga g
              ||||||||| ||| ||| |||||||| |||| ||||   || ||  
3'            gguucggug acu aag aggucgag ucac auca   ca uu g
   cuaaaaguucc         u   -   a        -    -    agu  g  a 
Get sequence
Deep sequencing
18 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 10605984-10606093 [-]
intergenic
Database links

Mature sequence gga-miR-6613-3p

Accession MIMAT0025708
Sequence

70 - 

acacugagcuggaagaaucaug

 - 91

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).