Stem-loop sequence gga-mir-6615

AccessionMI0022434 (change log)
DescriptionGallus gallus miR-6615 stem-loop
Stem-loop
   ccugaauuccagacaa a   u        ---       c     aaca       cu  g 
5'                 g cac ggggcuug   gggacac aucag    gccacag  gu c
                   | ||| ||||||||   ||||||| |||||    |||||||  || u
3'                 c gug uccuggac   ucuugug uaguc    cgguguc  ua g
   -------cgagacagg -   c        acc       -     ---a       -u  g 
Get sequence
Deep sequencing
821 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr28: 1760725-1760835 [-]
sense
ENSGALT00000002347 ; ADAMTS10-201; exon 20
Database links

Mature sequence gga-miR-6615-5p

Accession MIMAT0025710
Sequence

28 - 

uuggggacaccaucagaacagcca

 - 51

Get sequence
Deep sequencing805 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6615-3p

Accession MIMAT0025711
Sequence

70 - 

uggcacugauguguucuccaca

 - 91

Get sequence
Deep sequencing16 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).