Stem-loop sequence gga-mir-6616

AccessionMI0022435 (change log)
DescriptionGallus gallus miR-6616 stem-loop
Literature search

1 open access papers mention gga-mir-6616
(1 sentences)

Stem-loop
   guucugcuggcggggaa         uga     ag   ag   ggg   ----u -       u 
5'                  ggagcucug   uggcu  cug  aug   gau     c agccauc u
                    |||||||||   |||||  |||  |||   |||     | |||||||  
3'                  cuucgagac   gucgg  gac  uac   cug     g ucggugg c
   ---------------aa         uug     --   gu   aga   uucgu c       u 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 92351545-92351654 [+]
intergenic
Database links

Mature sequence gga-miR-6616-5p

Accession MIMAT0025712
Sequence

21 - 

gcucugugauggcuagcugaga

 - 42

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).