Stem-loop sequence gga-mir-6617

AccessionMI0022436 (change log)
DescriptionGallus gallus miR-6617 stem-loop
Stem-loop
   uggagugcucgagcggcuccaaca    g          -g      uaga    uuc 
5'                         agag agcgacuggc  gcucug    gcuu   g
                           |||| ||||||||||  ||||||    ||||   g
3'                         ucuu uugcugacug  cgagac    ugaa   c
   -------gucguagaaaaaggcaa    -          ga      uuug    cga 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr9: 16236774-16236883 [-]
intergenic
Database links

Mature sequence gga-miR-6617-3p

Accession MIMAT0025713
Sequence

67 - 

uguuucagagcaggucagucguu

 - 89

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).