Stem-loop sequence gga-mir-6618

AccessionMI0022437 (change log)
DescriptionGallus gallus miR-6618 stem-loop
Stem-loop
   -----cggcacccaucuccc c    c  c    -        ucc     u  cug 
5'                     g cgag ag agag gcugcugu   ucucc gc   c
                       | |||| || |||| ||||||||   ||||| ||    
3'                     c gcuc uc ucuc cgacgacg   agggg cg   a
   cgacgacgaaugcauucccu c    c  c    u        cuc     c  uug 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr26: 1761691-1761800 [-]
sense
ENSGALT00000000819 ; PLEKHA6-201; intron 1
Database links

Mature sequence gga-miR-6618-5p

Accession MIMAT0025714
Sequence

26 - 

agaggcugcuguuccucuccug

 - 47

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).