Stem-loop sequence gga-mir-6619

AccessionMI0022438 (change log)
DescriptionGallus gallus miR-6619 stem-loop
Stem-loop
   -----gcaaagcgcuggggagccccga          -    - -      caaugcc 
5'                            ggagaaguga cgga g cagugc       c
                              |||||||||| |||| | ||||||        
3'                            ccucuuuauu gccu c guuacg       c
   uaggugcggugugcaguaaacacgacc          u    g a      ccccucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
AADN04005953.1: 4248-4357 [-]
intergenic
KQ759536.1: 59735-59844 [+]
intergenic
Database links

Mature sequence gga-miR-6619-5p

Accession MIMAT0025715
Sequence

22 - 

aggagaagugacggagcagugc

 - 43

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).