Stem-loop sequence gga-mir-4732

AccessionMI0022440 (change log)
DescriptionGallus gallus miR-4732 stem-loop
Stem-loop
   ggaugccagccuggucuccc       -  g         -     auaug   --g    ca 
5'                     aaaccuu ug aggagggag cagga     gga   caca  c
                       ||||||| || ||||||||| |||||     |||   ||||   
3'                     uuuggga ac ucuuucuuc guccu     ucu   gugu  u
   ---------ugguccucguc       c  g         u     -----   aga    ag 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 30430042-30430151 [-]
sense
ENSGALT00000016725 ; TMEM63B-201; exon 6
Database links

Mature sequence gga-miR-4732-5p

Accession MIMAT0025717
Sequence

28 - 

uggaggagggagcaggaauau

 - 48

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).