Stem-loop sequence gga-mir-6621

AccessionMI0022441 (change log)
DescriptionGallus gallus miR-6621 stem-loop
Stem-loop
   ---------ucaccacauag     gagca      uu      - u     gacu      
5'                     guuau     caggga  acaggg c cugag    cugca 
                       |||||     ||||||  |||||| | |||||    |||| g
3'                     cggug     guuccu  uguccc g gacuu    gacga 
   ggaacggggugaacggacgg     -agac      cu      u u     --ac      
Get sequence
Deep sequencing
25 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 2713344-2713453 [+]
sense
ENSGALT00000010457 ; PLXNA4-201; 3'UTR (exon 25)
Database links

Mature sequence gga-miR-6621-5p

Accession MIMAT0025718
Sequence

21 - 

acagggauuacagggcucuga

 - 41

Get sequence
Deep sequencing12 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).