Stem-loop sequence gga-mir-6623

AccessionMI0022442 (change log)
DescriptionGallus gallus miR-6623 stem-loop
Stem-loop
   -au    uaucu  ug     a   a      c  auc        ca    uaaauc 
5'    gaug     gc  guuug gcu gaaaag ug   cuucagcu  guga      a
      ||||     ||  ||||| ||| |||||| ||   ||||||||  ||||       
3'    cuau     cg  uagac cga cuuuuc ac   gaggucga  cacu      c
   cuu    ----u  gu     c   a      u  -ca        --    uaccuu 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 24695552-24695661 [-]
sense
ENSGALT00000017363 ; SLC1A7-201; intron 3
Database links

Mature sequence gga-miR-6623-3p

Accession MIMAT0025719
Sequence

68 - 

acagcuggagaccaucuuuuca

 - 89

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).