Stem-loop sequence gga-mir-6624

AccessionMI0022443 (change log)
DescriptionGallus gallus miR-6624 stem-loop
Stem-loop
   --ccccccccccccca    ccc    -u          --  a   ag  aaca   gc 
5'                 gugu   cugc  gcagaagcuc  cc cug  gc    cag  a
                   ||||   ||||  ||||||||||  || |||  ||    |||   
3'                 caca   gacg  ugucuucggg  gg gac  cg    guc  g
   acauuagucucgucaa    --a    uu          aa  -   cu  ----   ac 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr7: 16321986-16322095 [+]
intergenic
Database links

Mature sequence gga-miR-6624-3p

Accession MIMAT0025720
Sequence

65 - 

uccagggaagggcuucuguuu

 - 85

Get sequence
Deep sequencing13 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).