Stem-loop sequence gga-mir-6625

AccessionMI0022444 (change log)
DescriptionGallus gallus miR-6625 stem-loop
Stem-loop
   ----cuaacaucacggg     u    ccuug     ac       a  -      g g 
5'                  uagcu cugu     gggga  uggaagc ag agucag a g
                    ||||| ||||     |||||  ||||||| || |||||| |  
3'                  gucgg gacg     ccccu  aucuuug uc uuaguc u g
   uccucuaacgacguuag     c    -----     cu       g  g      g a 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr10: 2314973-2315082 [-]
sense
ENSGALT00000022849 ; SCAMP5-201; exon 6
Database links

Mature sequence gga-miR-6625-5p

Accession MIMAT0025721
Sequence

27 - 

ugggggaacuggaagcaagagu

 - 48

Get sequence
Deep sequencing37 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).