Stem-loop sequence gga-mir-6626

AccessionMI0022445 (change log)
DescriptionGallus gallus miR-6626 stem-loop
Stem-loop
   ------cuguagcccgcauaaagcaaagugcuaa    a        -uu  -u  ac 
5'                                   ggag gagaaggg   gc  gu  u
                                     |||| ||||||||   ||  ||   
3'                                   ccuc cucuuucc   cg  cg  c
   aaaggucgcgaagauuucuugagugaugaucgga    c        uuu  uc  aa 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr21: 4626344-4626453 [-]
sense
ENSGALT00000006223 ; UBR4-201; exon 50
Database links

Mature sequence gga-miR-6626-5p

Accession MIMAT0025722
Sequence

28 - 

aggagagagaaggguugcu

 - 46

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).