Stem-loop sequence gga-mir-6627

AccessionMI0022446 (change log)
DescriptionGallus gallus miR-6627 stem-loop
Stem-loop
   ucccaucuuggguuu  -g    c    uu  ug ca    u  c   gg    ug  gu 
5'                ug  ggag ugcu  uc  c  cauu cc uca  ccug  gu  u
                  ||  |||| ||||  ||  |  |||| || |||  ||||  ||   
3'                ac  ucuc acgg  ag  g  guag gg agu  gggu  ua  u
   -----------uagu  ag    c    gu  gu uc    u  a   aa    gu  gg 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 90285196-90285305 [-]
intergenic
Database links

Mature sequence gga-miR-6627-3p

Accession MIMAT0025723
Sequence

70 - 

ggaaugaaggugaugcugugga

 - 91

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).