Stem-loop sequence gga-mir-6628

AccessionMI0022447 (change log)
DescriptionGallus gallus miR-6628 stem-loop
Stem-loop
   ucccuccuguaucuac  aa    -       -aa   u     -       g    a  gg 
5'                 gu  uggu uugggca   gcc ggguc cgacuuu ugcu ug  g
                   ||  |||| |||||||   ||| ||||| ||||||| |||| ||  a
3'                 cg  acca gauccgu   cgg uccgg gcugaag acga ac  a
   -----------cuuaa  -g    c       aca   -     u       -    g  ag 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 12131149-12131258 [-]
intergenic
Database links

Mature sequence gga-miR-6628-3p

Accession MIMAT0025724
Sequence

70 - 

cagaagucguggccuggcaca

 - 90

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).