Stem-loop sequence gga-mir-6629

AccessionMI0022448 (change log)
DescriptionGallus gallus miR-6629 stem-loop
Stem-loop
   -----------    g  g   c    -c  a  u      -uu  gg      uu    g  a 
5'            aucu ug ugc agaa  ag gc gggaac   ga  cagcug  gagu cu a
              |||| || ||| ||||  || || ||||||   ||  ||||||  |||| ||  
3'            ugga ac acg ucuu  uc cg uccuug   cu  gucgac  cucg ga g
   gugguugacuu    -  g   -    ac  -  c      ucc  -a      --    -  g 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 917736-917845 [+]
sense
ENSGALT00000013005 ; KLHDC10-201; intron 6
Database links

Mature sequence gga-miR-6629-5p

Accession MIMAT0025725
Sequence

22 - 

cugggaacuugaggcagcuguugagu

 - 47

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).