Stem-loop sequence gga-mir-6630

AccessionMI0022449 (change log)
DescriptionGallus gallus miR-6630 stem-loop
Stem-loop
   cggagcuauguaaaagu     c      ----cuca        aga   -a       g   aa 
5'                  agaag gaggua        ggaagguc   ggu  gugcagg agg  a
                    ||||| ||||||        ||||||||   |||  ||||||| |||   
3'                  ucuuu cuccau        uuuuucgg   cca  cacgucc ucc  c
   -----------------     -      acucuuug        aag   aa       -   ga 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 129537724-129537833 [-]
sense
ENSGALT00000021805 ; NCALD-201; intron 1
Database links

Mature sequence gga-miR-6630-3p

Accession MIMAT0025726
Sequence

70 - 

cugcacaaaccgaaggcuuuuu

 - 91

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).