Stem-loop sequence gga-mir-6633

AccessionMI0022452 (change log)
DescriptionGallus gallus miR-6633 stem-loop
Stem-loop
   --------------ua     --  u    -ucacca    a   ua  g   -       ca 
5'                 gaagc  ca gagu       gagg aac  ug cug acuguaa  u
                   |||||  || ||||       |||| |||  || ||| |||||||   
3'                 cuucg  gu cuua       cucc uug  ac gac ugacauu  g
   uacaaacuucuugaga     uc  c    ucuccua    g   ua  a   a       ua 
Get sequence
Deep sequencing
38 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 80493163-80493272 [+]
intergenic
Database links

Mature sequence gga-miR-6633-5p

Accession MIMAT0025729
Sequence

20 - 

agaggaaacuauggcugacugu

 - 41

Get sequence
Deep sequencing37 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).