Stem-loop sequence gga-mir-6634

AccessionMI0022453 (change log)
DescriptionGallus gallus miR-6634 stem-loop
Stem-loop
   -     a g  gc   aaga   -    c     guuc   a    -c     g  gu 
5'  agucu u ag  cau    cau acuu ucagg    uga ggag  uggcu ag  g
    ||||| | ||  |||    ||| |||| |||||    ||| ||||  ||||| ||  g
3'  ucagg g uc  gua    gua ugaa aguuu    acu ccuc  accga uc  u
   g     a g  -a   ---g   c    a     --ac   a    uu     g  au 
Get sequence
Deep sequencing
149 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 89887286-89887395 [-]
antisense
ENSGALT00000026359 ; CSMD1-201; intron 2
Database links

Mature sequence gga-miR-6634-5p

Accession MIMAT0025730
Sequence

26 - 

ucucaggguucugaaggagcuggc

 - 49

Get sequence
Deep sequencing126 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).