Stem-loop sequence gga-mir-6637-2

AccessionMI0022457 (change log)
DescriptionGallus gallus miR-6637-2 stem-loop
Gene family MIPF0001482; mir-6637
Stem-loop
   cggcgugu  gu ug -g     aa       --aa gc      -      a     ag 
5'         gg  g  a  agagg  ggcagcg    g  ugcagg gcgguc ggcgg  g
           ||  |  |  |||||  |||||||    |  |||||| |||||| |||||   
3'         cc  u  u  uuucc  ccguugc    c  acgucc ugucgg ucgcc  a
   ------cc  ug gu aa     --       gugg ua      g      g     ga 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr23: 5232873-5232982 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-6637-2
gga-mir-6637-1chr23: 5225417-5225526 [+]
gga-mir-6637-2chr23: 5232873-5232982 [+]
Database links

Mature sequence gga-miR-6637-3p

Accession MIMAT0025733
Sequence

63 - 

gcugggcugugccugcaaucggu

 - 85

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).