Stem-loop sequence gga-mir-6639

AccessionMI0022458 (change log)
DescriptionGallus gallus miR-6639 stem-loop
Stem-loop
   uggaugac   ag      --    auua       acuu     u   u   gaguuua 
5'         ggu  aaaaag  acaa    uuacaga    cggca gau gcu       a
           |||  ||||||  ||||    |||||||    ||||| ||| |||        
3'         uca  uuuuuc  uguu    gaugucu    gucgu cug cga       a
   ----agua   gg      aa    ---g       --gu     -   u   aauggau 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr19: 8696086-8696195 [-]
sense
ENSGALT00000008849 ; HEATR6-201; exon 15
Database links

Mature sequence gga-miR-6639-5p

Accession MIMAT0025735
Sequence

29 - 

uacagaacuucggcaugauugcu

 - 51

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).