Stem-loop sequence gga-mir-6640

AccessionMI0022459 (change log)
DescriptionGallus gallus miR-6640 stem-loop
Stem-loop
   ------aa     guaa    u        ---aauu          guau     u   a 
5'         uguug    uuau uuaucugg       guaguagagu    uauua ggc u
           |||||    |||| ||||||||       ||||||||||    ||||| |||  
3'         acagc    agua aguggacu       cgucaucucg    guaau ccg g
   caggcagc     agga    u        guucuuu          ----     -   u 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 22223149-22223258 [+]
sense
ENSGALT00000016032 ; SLC30A1-201; 3'UTR (exon 3)
Database links

Mature sequence gga-miR-6640-5p

Accession MIMAT0025736
Sequence

20 - 

ucuggaauuguaguagaguguau

 - 42

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).