Stem-loop sequence gga-mir-6641

AccessionMI0022460 (change log)
DescriptionGallus gallus miR-6641 stem-loop
Stem-loop
   ---------aaaaa  a  u    a  g c         a        uaau    u 
5'               ug uu ccuu ca a agcuuuuuu uuuccagu    gugu u
                 || || |||| || | ||||||||| ||||||||    |||| u
3'               ac ag ggaa gu u ucgaaaaaa gagggucg    caua a
   acggagaacaaaag  -  u    c  g a         -        --uc    a 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 179212021-179212124 [+]
sense
ENSGALT00000036438 ; PSPC1-201; intron 7
Database links

Mature sequence gga-miR-6641-5p

Accession MIMAT0025737
Sequence

20 - 

acagcuuuuuuauuuccaguua

 - 41

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6641-3p

Accession MIMAT0025738
Sequence

57 - 

cugcugggagaaaaaagcuau

 - 77

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).