Stem-loop sequence gga-mir-6643

AccessionMI0022462 (change log)
DescriptionGallus gallus miR-6643 stem-loop
Stem-loop
   ----aggaaccuggucccaggaaccccagc                 ag   auac 
5'                               cccagggcuggcagggg  ggu    g
                                 |||||||||||||||||  |||    c
3'                               ggguuccgaccgucccc  ccg    a
   gaacgagaccccgaagacccuuugguggca                 -a   acgg 
Get sequence
Deep sequencing
25 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr14: 13204038-13204147 [-]
sense
ENSGALT00000045176 ; gga-mir-6643-201; 3'UTR (exon 9)
antisense
ENSGALT00000001529 ; gga-mir-6643-201; exon 7
Database links

Mature sequence gga-miR-6643-5p

Accession MIMAT0025741
Sequence

28 - 

ccagggcuggcaggggagggu

 - 48

Get sequence
Deep sequencing24 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).