Stem-loop sequence gga-mir-6645

AccessionMI0022463 (change log)
DescriptionGallus gallus miR-6645 stem-loop
Stem-loop
   --    --c   agu     caguu      gu        u     -cag   u    g 
5'   ugag   ccu   guccc     ugggag  agcagugg gguga    ugg ggug u
     ||||   |||   |||||     ||||||  |||||||| |||||    ||| ||||  
3'   acuu   gga   uaggg     acccuc  ucgucacc ccacu    acc ccac g
   ag    aaa   --g     -----      uc        c     caca   c    a 
Get sequence
Deep sequencing
358 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr5: 39173710-39173819 [+]
sense
ENSGALT00000016945 ; TMEM63C-201; 3'UTR (exon 5)
Database links

Mature sequence gga-miR-6645-5p

Accession MIMAT0025742
Sequence

22 - 

ugggagguagcaguggugguga

 - 43

Get sequence
Deep sequencing351 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).