Stem-loop sequence gga-mir-6647

AccessionMI0022465 (change log)
DescriptionGallus gallus miR-6647 stem-loop
Stem-loop
   -ag       --c      --    c        cu  cc   ug c       uaaa 
5'    ugcuugc   cuggcu  gcug gcuccgcu  gg  aug  a gcagcug    u
      |||||||   ||||||  |||| ||||||||  ||  |||  | |||||||     
3'    gcggacg   gaccga  cgac cgggguga  cc  uac  u cgucgau    u
   cga       cac      ca    a        --  au   gu -       gaac 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 19872411-19872520 [-]
intergenic
Database links

Mature sequence gga-miR-6647-5p

Accession MIMAT0025744
Sequence

26 - 

cgcucuggccaugugacgcagcu

 - 48

Get sequence
Deep sequencing7 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).