Stem-loop sequence gga-mir-6649

AccessionMI0022468 (change log)
DescriptionGallus gallus miR-6649 stem-loop
Stem-loop
   ugagcuguucuccggggauggugacacugugucugaa   u      -          -        u  a     a        gac 
5'                                      gcc ugcagc agcucuuggu uuaucaca ca ugcca gcagguau   a
                                        ||| |||||| |||||||||| |||||||| || ||||| ||||||||   g
3'                                      ugg guguug uuggggaccg gauggugu gu acggu cguucaua   g
   -------------------------------------   u      a          u        c  g     -        aag 
Get sequence
Deep sequencing
199 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 8585318-8585456 [-]
sense
ENSGALT00000003147 ; PIGO-201; intron 5
Database links

Mature sequence gga-miR-6649-5p

Accession MIMAT0025748
Sequence

57 - 

uuuaucacaucaaugccaagcag

 - 79

Get sequence
Deep sequencing182 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-6649-3p

Accession MIMAT0025749
Sequence

98 - 

ugcuggcagugcugugguagug

 - 119

Get sequence
Deep sequencing16 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).