Stem-loop sequence gga-mir-6650

AccessionMI0022469 (change log)
DescriptionGallus gallus miR-6650 stem-loop
Stem-loop
   u   uug    ----     -   g   a          aa ag       g     gc 
5'  ggu   uagg    cugca ucu aca cagccagcag  g  caacugg caggu  u
    |||   ||||    ||||| ||| ||| ||||||||||  |  ||||||| |||||   
3'  ccg   gucc    gacgu aga ugu gucggucguc  c  guugacc guccg  g
   c   -ua    uagg     c   a   c          -- -g       -     uc 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr15: 7731013-7731122 [-]
sense
ENSGALT00000009136 ; CHEK2-201; intron 12
Database links

Mature sequence gga-miR-6650-5p

Accession MIMAT0025750
Sequence

26 - 

agccagcagaagagcaacugggca

 - 49

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).