Stem-loop sequence gga-mir-6652

AccessionMI0022471 (change log)
DescriptionGallus gallus miR-6652 stem-loop
Stem-loop
   -------------cucuc     cc     gc    u  a      a a    agug     a 
5'                   caugc  ugccu  uggg gu uguggg c gcuc    ccccc c
                     |||||  |||||  |||| || |||||| | ||||    ||||| a
3'                   gugcg  acggg  accc ca acaccc g cgag    ggggg g
   acaacgaccaccgaccca     --     uc    c  -      c a    ---a     a 
Get sequence
Deep sequencing
3 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr13: 8923374-8923483 [+]
intergenic
Database links

Mature sequence gga-miR-6652-5p

Accession MIMAT0025752
Sequence

20 - 

uggguguaugugggacagcuc

 - 40

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).