Stem-loop sequence gga-mir-3524b

AccessionMI0022472 (change log)
DescriptionGallus gallus miR-3524b stem-loop
Stem-loop
   ----     ggcuuuaagauc           a          ug         -----    a 
5'     ggguu            ccuuccgaccu agucauucua  auucuguga     ugau a
       |||||            ||||||||||| ||||||||||  |||||||||     |||| a
3'     uccaa            ggaagguugga ucgguagggu  uaagacacu     acua g
   gucc     ------------           g          gu         aagac    a 
Get sequence
Deep sequencing
220 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 95943670-95943779 [-]
intergenic
Database links

Mature sequence gga-miR-3524b-3p

Accession MIMAT0025753
Sequence

70 - 

cacagaauugugggauggcug

 - 90

Get sequence
Deep sequencing140 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).