Stem-loop sequence gga-mir-6653

AccessionMI0022473 (change log)
DescriptionGallus gallus miR-6653 stem-loop
Stem-loop
   uacagcugaccuguuggcuuug    auu      a  ga g    c       u    ugc 
5'                       cagc   cccagc cc  c cugc auucugc gccu   u
                         ||||   |||||| ||  | |||| ||||||| ||||    
3'                       gucg   gggucg gg  g gacg uagggcg cggg   g
   --------------acucaaug    guc      c  ac a    -       -    ucu 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 28849709-28849818 [-]
intergenic
Database links

Mature sequence gga-miR-6653-3p

Accession MIMAT0025754
Sequence

71 - 

cgcgggaugcagagcaggcgc

 - 91

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).