Stem-loop sequence gga-mir-6654

AccessionMI0022474 (change log)
DescriptionGallus gallus miR-6654 stem-loop
Stem-loop
   ucucaccucaccgccucccucu              --       ga   a  c c   ugu 
5'                       gcugcuuucccugu  gcucagc  cgg gc g agc   g
                         ||||||||||||||  |||||||  ||| || | |||   u
3'                       cgacgggagggacg  cgagucg  guc cg c ucg   g
   --------------cuaccccc              gu       gg   a  a -   uga 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr26: 2853093-2853202 [-]
intergenic
Database links

Mature sequence gga-miR-6654-3p

Accession MIMAT0025755
Sequence

69 - 

ucagcacuggggcugagcuggca

 - 91

Get sequence
Deep sequencing17 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).