Stem-loop sequence gga-mir-6655

AccessionMI0022475 (change log)
DescriptionGallus gallus miR-6655 stem-loop
Stem-loop
   -----------------aaau   -       g  g u        ag     g       ggu 
5'                      ugg ugcccag ug u cugcuagg  gcugu uauccug   g
                        ||| ||||||| || | ||||||||  ||||| |||||||    
3'                      acc guggguu ac g gaugaucc  ugacg auaggac   c
   uaccucuucuggggguacguc   u       -  g u        cg     -       gac 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 97164290-97164399 [+]
sense
ENSGALT00000036903 ; HPCAL1-201; intron 2
AADN04014660.1: 969-1078 [-]
sense
ENSGALT00000036903 ; HPCAL1-201; intron 2
Database links

Mature sequence gga-miR-6655-5p

Accession MIMAT0025756
Sequence

20 - 

ucugcuaggaggcuguguauccu

 - 42

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).