Stem-loop sequence gga-mir-6656

AccessionMI0022476 (change log)
DescriptionGallus gallus miR-6656 stem-loop
Stem-loop
   aa     - -ccca       g        a    gag     a   g    uuaca 
5'   ggcag c     gagggug agggaugc gggc   uagag aag cauc     u
     ||||| |     ||||||| |||||||| ||||   ||||| ||| ||||      
3'   ucguu g     cuuccgu uuccuacg cccg   gucuc uuc gugg     c
   --     u auuuc       g        -    -gg     g   g    cuccu 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 175931282-175931391 [-]
antisense
ENSGALT00000027608 ; FLT1-201; 3'UTR (exon 25)
Database links

Mature sequence gga-miR-6656-5p

Accession MIMAT0025757
Sequence

26 - 

ugcagggcgaguagagaaaggcau

 - 49

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).