Stem-loop sequence gga-mir-6657

AccessionMI0022477 (change log)
DescriptionGallus gallus miR-6657 stem-loop
Stem-loop
   --a    -a     g    c  c     -- -   c   uu     gg    gg uug 
5'    ggga  aucag cucg ug ugcug  c ccc ucu  cacca  gucu  u   u
      ||||  ||||| |||| || |||||  | ||| |||  |||||  ||||  |   a
3'    uccu  uaguc gagu ac acgac  g ggg aga  guggu  cagg  g   c
   uca    ag     -    c  -     ca u   a   gg     -a    uu ugu 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr6: 20059129-20059238 [+]
sense
ENSGALT00000010562 ; TBC1D12-201; intron 3
Database links

Mature sequence gga-miR-6657-3p

Accession MIMAT0025758
Sequence

64 - 

acauggugggagaagggugac

 - 84

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).