Stem-loop sequence gga-mir-6658

AccessionMI0022478 (change log)
DescriptionGallus gallus miR-6658 stem-loop
Stem-loop
      ccc    cg  g    a -    cug    ag      c   ga   u  uaa 
5' cag   ugcu  ua cucc c cgcu   cucc  ccccug cca  gcc ca   a
   |||   ||||  || |||| | ||||   ||||  |||||| |||  ||| ||   u
3' guc   acga  gu gggg g gcga   gagg  gggggc ggu  cgg gu   a
      --u    cu  g    a a    -ua    aa      a   -a   u  cag 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 1209300-1209409 [-]
intergenic
Database links

Mature sequence gga-miR-6658-3p

Accession MIMAT0025759
Sequence

67 - 

cauggacgggggaaggagauagc

 - 89

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).