Stem-loop sequence gga-mir-6659

AccessionMI0022479 (change log)
DescriptionGallus gallus miR-6659 stem-loop
Stem-loop
   cccugucgucgagaguuaua              -    a      ug      ag  gcu 
5'                     guuaaccuuuagcc gguu ugaugg  gcuaaa  gu   u
                       |||||||||||||| |||| ||||||  ||||||  ||    
3'                     caauuggaaauugg ccag gcuacc  cgguuu  cg   c
   ------------ucguuuua              u    -      gu      cu  uac 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 1698306-1698415 [-]
sense
ENSGALT00000013814 ; EXOC4-201; intron 9
ENSGALT00000013813 ; EXOC4-202; intron 9
Database links

Mature sequence gga-miR-6659-3p

Accession MIMAT0025760
Sequence

70 - 

uuuggcugccaucggaccuggu

 - 91

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).