Stem-loop sequence gga-mir-6660

AccessionMI0022480 (change log)
DescriptionGallus gallus miR-6660 stem-loop
Stem-loop
   gaggagagugugcugaaaggugggcg        ug --------          -  g    -      a 
5'                           gcggugug  g        ugcggggcag gc gugu ggggcc c
                             ||||||||  |        |||||||||| || |||| ||||||  
3'                           cgucgcgc  c        acgccucguc cg uaca ucucgg c
   ------------------------ga        gu cucgucug          u  g    g      g 
Get sequence
Deep sequencing
204 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr10: 1503992-1504101 [-]
sense
ENSGALT00000003113 ; GRAMD2-201; exon 3
Database links

Mature sequence gga-miR-6660-3p

Accession MIMAT0025761
Sequence

68 - 

ucugacauggcucugcuccgcagu

 - 91

Get sequence
Deep sequencing188 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).