Stem-loop sequence gga-mir-6661

AccessionMI0022481 (change log)
DescriptionGallus gallus miR-6661 stem-loop
Stem-loop
   ------------gagucacuggaagcaguuca   ----         g    a     gug 
5'                                 ggg    cugcagcau caga gcugu   c
                                   |||    ||||||||| |||| |||||    
3'                                 ccc    gacgucgua gucu cgaca   u
   ggagucccgucgucgacacgguuccuccauca   uacg         g    a     gug 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 83231971-83232080 [+]
sense
ENSGALT00000025300 ; ZFYVE28-201; intron 1
Database links

Mature sequence gga-miR-6661-5p

Accession MIMAT0025762
Sequence

20 - 

agggcugcagcaugcagaagcu

 - 41

Get sequence
Deep sequencing18 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).