Stem-loop sequence gga-mir-6662

AccessionMI0022482 (change log)
DescriptionGallus gallus miR-6662 stem-loop
Stem-loop
   ----   ugac  a    ug  caa  c ug    a    ug    a    u  uca 
5'     guc    ca uggu  ac   gg u  gcca uggu  acca uggu ga   a
       |||    || ||||  ||   || |  |||| ||||  |||| |||| ||    
3'     cag    gu acca  ug   cc a  cggu acca  uggu accg cu   c
   uaac   -uuc  a    gu  aua  a gu    g    gu    a    -  ucu 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr25: 1637951-1638060 [-]
intergenic
AADN04006382.1: 7628-7737 [-]
intergenic
Database links

Mature sequence gga-miR-6662-3p

Accession MIMAT0025763
Sequence

64 - 

aaugguugaccaguggcugaac

 - 85

Get sequence
Deep sequencing6 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).