Stem-loop sequence gga-mir-6663

AccessionMI0022483 (change log)
DescriptionGallus gallus miR-6663 stem-loop
Stem-loop
   -----------------uuacu       g      a        -u a    -u    -  gga 
5'                       gagcuga cagcuc uugcugug  g ggag  gcug cc   g
                         ||||||| |||||| ||||||||  | ||||  |||| ||    
3'                       uucgauu gucgag aacgacac  c ccuc  cggc gg   a
   gauacgaggcguccgucuucac       -      -        cc a    uu    u  ggu 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr27: 4371072-4371181 [-]
intergenic
Database links

Mature sequence gga-miR-6663-5p

Accession MIMAT0025764
Sequence

20 - 

auugcugugugaggagugcug

 - 40

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:22418847 "Drastic expression change of transposon-derived piRNA-like RNAs and microRNAs in early stages of chicken embryos implies a role in gastrulation" Shao P, Liao JY, Guan DG, Yang JH, Zheng LL, Jing Q, Zhou H, Qu LH RNA Biol. 9:212-227(2012).